Kcnq2^em6Lutzy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Kcnq2^em6Lutzy
• Name: potassium voltage-gated channel, subfamily Q, member 2; endonuclease-mediated mutation 6, Cathy Lutz
• MGI ID: MGI:6883621
• Synonyms: Kcnq2^H228R
• Gene: Kcnq2 Location: Chr2:180717372-180777093 bp, - strand Genetic Position: Chr2, 103.57 cM, cytoband H3-4
• Alliance: Kcnq2^em6Lutzy page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Nucleotide substitutions
• Mutation details: CRISPR/cas9 genome editing using guide RNA (GGTAGTCTACGCTCACAGCA) to target exon 4. Donor DNAs were created encoding an H228R mutation (CAT to CGT, histidine to arginine) as well as a silent mutation S229S (AGC to TCC). (J:94077)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Kcnq2 Mutation: 48 strains or lines available

References

• Original: J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015
• All: 1 reference(s)