About   Help   FAQ
Adcy5em9Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Adcy5em9Lutzy
Name: adenylate cyclase 5; endonuclease-mediated mutation 9, Cathy Lutz
MGI ID: MGI:6883566
Synonyms: Adcy5R1014C
Gene: Adcy5  Location: Chr16:34975247-35126108 bp, + strand  Genetic Position: Chr16, 24.71 cM, cytoband B-5
Alliance: Adcy5em9Lutzy page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Not Specified)
Mutation:    Nucleotide substitutions
 
Mutation detailsCRISPR/cas9 genome editing used guide RNAs (GCAGTTTCCAGAGGAAGTCA and GAGGAAGTCAAGGCGAGCAG) to target exon 17. Donor DNAs were created encoding a R1014C mutation (CGC to TGT, arginine to cysteine). (J:94077)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Adcy5 Mutation:  67 strains or lines available
References
Original:  J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory