Adcy5^em4Lutzy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Adcy5^em4Lutzy
• Name: adenylate cyclase 5; endonuclease-mediated mutation 4, Cathy Lutz
• MGI ID: MGI:6883554
• Synonyms: Adcy5^del101
• Gene: Adcy5 Location: Chr16:34975247-35126108 bp, + strand Genetic Position: Chr16, 24.71 cM, cytoband B-5
• Alliance: Adcy5^em4Lutzy page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/cas9 genome editing used Guide RNAs (TGGGTCGGGCCATCGATGCC and TCGCAGTCTGTCGATGCTCC) selected to target exon 10, sequencing identified a 101 bp deletion beginning in exon 10 and terminating in intron 10. (J:94077)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Adcy5 Mutation: 67 strains or lines available

References

• Original: J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015
• All: 1 reference(s)