About   Help   FAQ
Adcy5em2Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Adcy5em2Lutzy
Name: adenylate cyclase 5; endonuclease-mediated mutation 2, Cathleen Lutz
MGI ID: MGI:6879499
Synonyms: Adcy5A727T
Gene: Adcy5  Location: Chr16:34975247-35126108 bp, + strand  Genetic Position: Chr16, 24.71 cM, cytoband B-5
Alliance: Adcy5em2Lutzy page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Not Specified)
Mutation:    Nucleotide substitutions
 
Mutation detailsCRISPR/cas9 genome editing used guide RNAs (TGGGTCGGGCCATCGATGCC and TCGCAGTCTGTCGATGCTCC) to target exon 10. Donor DNAs were created encoding a A727T mutation (GCC to ACA, alanine to threonine). (J:94077)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Adcy5 Mutation:  66 strains or lines available
References
Original:  J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/16/2024
MGI 6.23
The Jackson Laboratory