Tent5d^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tent5d^em1(IMPC)J
• Name: terminal nucleotidyltransferase 5D; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6879492
• Gene: Tent5d Location: ChrX:106836196-106916515 bp, + strand Genetic Position: ChrX, 47.62 cM
• Alliance: Tent5d^em1(IMPC)J page
• IMPC: Tent5d gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTGAATGCAAACATGTTCCC and TGGTATGATTGCTAAAAGTT, which resulted in a 3070 bp deletion beginning at Chromosome X position 107,870,055 bp and ending after 107,873,124 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000653984 (exon 6) and 455 bp of flanking intronic sequence including the splice acceptor and start site and is predicted to result in a null allele. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Tent5d Mutation: 3 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)