Mir455^em1Asah
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mir455^em1Asah
• Name: microRNA 455; endonuclease-mediated mutation 1, Hiroshi Asahara
• MGI ID: MGI:6874618
• Synonyms: miR-455^-
• Gene: Mir455 Location: Chr4:63175088-63175169 bp, + strand Genetic Position: Chr4, 33.96 cM
• Alliance: Mir455^em1Asah page

Mutation origin

• Strain of Origin: (C57BL/6 x DBA/2)F1

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 technology generated a 22-bp deletion (CTTTGGACTACATCGTGAACGC) that includes the miR-455-5p mature sequences. Neither miR-455-5p nor miR-455-3p are expressed in primary chondrocytes. Although miR-455 is located in intron 10 of Col27a1, expression of Col27a1 is not changed in chondrocytes indicating that Col27a1 is not affected by this deletion. (J:320585)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Mir455 Mutation: 2 strains or lines available

References

• Original: J:320585 Ito Y, et al., Both microRNA-455-5p and -3p repress hypoxia-inducible factor-2alpha expression and coordinately regulate cartilage homeostasis. Nat Commun. 2021 Jul 6;12(1):4148
• All: 1 reference(s)