About   Help   FAQ
Mir455em1Asah
Endonuclease-mediated Allele Detail
Summary
Symbol: Mir455em1Asah
Name: microRNA 455; endonuclease-mediated mutation 1, Hiroshi Asahara
MGI ID: MGI:6874618
Synonyms: miR-455-
Gene: Mir455  Location: Chr4:63175088-63175169 bp, + strand  Genetic Position: Chr4, 33.96 cM
Alliance: Mir455em1Asah page
Mutation
origin
Strain of Origin:  (C57BL/6 x DBA/2)F1
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsCRISPR/Cas9 technology generated a 22-bp deletion (CTTTGGACTACATCGTGAACGC) that includes the miR-455-5p mature sequences. Neither miR-455-5p nor miR-455-3p are expressed in primary chondrocytes. Although miR-455 is located in intron 10 of Col27a1, expression of Col27a1 is not changed in chondrocytes indicating that Col27a1 is not affected by this deletion. (J:320585)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Mir455 Mutation:  2 strains or lines available
References
Original:  J:320585 Ito Y, et al., Both microRNA-455-5p and -3p repress hypoxia-inducible factor-2alpha expression and coordinately regulate cartilage homeostasis. Nat Commun. 2021 Jul 6;12(1):4148
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/13/2026
MGI 6.24
The Jackson Laboratory