About   Help   FAQ
Samd9lem2Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Samd9lem2Lutzy
Name: sterile alpha motif domain containing 9-like; endonuclease-mediated mutation 2, Cathy Lutz
MGI ID: MGI:6867255
Synonyms: Samd9ldel43
Gene: Samd9l  Location: Chr6:3372257-3399458 bp, - strand  Genetic Position: Chr6, 1.76 cM, cytoband A1-A2
Alliance: Samd9lem2Lutzy page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Not Specified)
Mutation:    Intragenic deletion
 
Mutation detailsCRISPR/cas9 genome editing used guide RNAs (AGCCTTTGAGGCCAAACTAC, CAAACTACAGGAAATTGAAA and TATTCGTTCATGATCTTGAA) originally designed to introduce an H871Q mutation. DNA sequencing of the targeted region identified a 43 bp deletion (indel mutation) in exon 2. (J:101977)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Samd9l Mutation:  95 strains or lines available
References
Original:  J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory