Samd9l^em2Lutzy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Samd9l^em2Lutzy
• Name: sterile alpha motif domain containing 9-like; endonuclease-mediated mutation 2, Cathleen Lutz
• MGI ID: MGI:6867255
• Synonyms: Samd9l^del43
• Gene: Samd9l Location: Chr6:3372257-3399571 bp, - strand Genetic Position: Chr6, 1.76 cM, cytoband A1-A2
• Alliance: Samd9l^em2Lutzy page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/cas9 genome editing used guide RNAs (AGCCTTTGAGGCCAAACTAC, CAAACTACAGGAAATTGAAA and TATTCGTTCATGATCTTGAA) originally designed to introduce an H871Q mutation. DNA sequencing of the targeted region identified a 43 bp deletion (indel mutation) in exon 2. (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Samd9l Mutation: 95 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 1 reference(s)