Kif1a^em13Lutzy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Kif1a^em13Lutzy
• Name: kinesin family member 1A; endonuclease-mediated mutation 13, Cathleen Lutz
• MGI ID: MGI:6865786
• Synonyms: Kif1a^indel
• Gene: Kif1a Location: Chr1:92943186-93029673 bp, - strand Genetic Position: Chr1, 46.74 cM, cytoband E1-E2
• Alliance: Kif1a^em13Lutzy page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Insertion
• Mutation details: CRISPR/cas9 genome editing used guide RNAs (TTTCCCGGGAGTTGAAGGGG and TCATTTCCCGGGAGTTGAAG) to target exon 2, which resulted in a 1 bp insertion (T) in exon 2 (indel mutation). (J:94077)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Kif1a Mutation: 95 strains or lines available

References

• Original: J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015
• All: 1 reference(s)