Atg7^em1Lutzy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Atg7^em1Lutzy
• Name: autophagy related 7; endonuclease-mediated mutation 1, Cathy Lutz
• MGI ID: MGI:6864524
• Synonyms: Atg7 cKO
• Gene: Atg7 Location: Chr6:114620075-114837565 bp, + strand Genetic Position: Chr6, 53.05 cM, cytoband E3
• Alliance: Atg7^em1Lutzy page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready)
• Mutation: Insertion
• Mutation details: CRISPR/cas9 genome editing used crRNAs to insert loxP sites upstream (GCTCATTCCCATAATGAACC; CCCCCCGCCAGGTTCATTAT) and downstream (TAACAGTAACCACACCAACA; GTTTCTCTGCCATGTTGGTG) regions of exon 5 (ENSEMBL Transcript ID: ENSMUSE00001222215). (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Atg7 Mutation: 52 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 1 reference(s)