About   Help   FAQ
Atg7em1Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Atg7em1Lutzy
Name: autophagy related 7; endonuclease-mediated mutation 1, Cathy Lutz
MGI ID: MGI:6864524
Synonyms: Atg7 cKO
Gene: Atg7  Location: Chr6:114620075-114837565 bp, + strand  Genetic Position: Chr6, 53.05 cM, cytoband E3
Alliance: Atg7em1Lutzy page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready)
Mutation:    Insertion
 
Mutation detailsCRISPR/cas9 genome editing used crRNAs to insert loxP sites upstream (GCTCATTCCCATAATGAACC; CCCCCCGCCAGGTTCATTAT) and downstream (TAACAGTAACCACACCAACA; GTTTCTCTGCCATGTTGGTG) regions of exon 5 (ENSEMBL Transcript ID: ENSMUSE00001222215). (J:101977)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Atg7 Mutation:  52 strains or lines available
References
Original:  J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory