About   Help   FAQ
Atg5em2Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Atg5em2Lutzy
Name: autophagy related 5; endonuclease-mediated mutation 2, Cathy Lutz
MGI ID: MGI:6864522
Synonyms: Atg5 cKO
Gene: Atg5  Location: Chr10:44144354-44240287 bp, + strand  Genetic Position: Chr10, 23.24 cM
Alliance: Atg5em2Lutzy page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready)
Mutation:    Insertion
 
Mutation detailsCRISPR/cas9 genome editing used crRNAs to insert loxP sites upstream (TAACTGTGCGGCCACATGAT; GTGTGTACTGACCAATCATG and downstream (GCTGAGCCAGACCTTTGTGC; GCACAAAGGTCTGGCTCAGC) regions of exon 4. (J:101977)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Atg5 Mutation:  29 strains or lines available
References
Original:  J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory