About   Help   FAQ
Kif1aem2Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Kif1aem2Lutzy
Name: kinesin family member 1A; endonuclease-mediated mutation 2, Cathy Lutz
MGI ID: MGI:6864483
Synonyms: Kif1aI304I,P305L
Gene: Kif1a  Location: Chr1:92943186-93029673 bp, - strand  Genetic Position: Chr1, 46.74 cM, cytoband E1-E2
Alliance: Kif1aem2Lutzy page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutations:    Insertion, Nucleotide substitutions
 
Mutation detailsCRISPR/cas9 genome editing used guide RNAs (TCAATACGGAGTCTCGGTAA, GTCAATACGGAGTCTCGGTA, and TGTCAATACGGAGTCTCGGTA) to target exon 11. Donor DNAs were created encoding a P305L mutation (CCT to CTT, proline to leucine) and a silent mutation I304I (ATC to ATA) that introduces a Setl site. The P305L (proline to leucine) mutation was identified in children with KIF1A-associated neurological disorder (KAND), a neurodegenerative condition. (J:101977)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Kif1a Mutation:  95 strains or lines available
References
Original:  J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory