About   Help   FAQ
Dhpsem5Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Dhpsem5Lutzy
Name: deoxyhypusine synthase; endonuclease-mediated mutation 5, Cathy Lutz
MGI ID: MGI:6864100
Synonyms: Dhpsdel7
Gene: Dhps  Location: Chr8:85798386-85801791 bp, + strand  Genetic Position: Chr8, 41.55 cM
Alliance: Dhpsem5Lutzy page
Mutation
origin
Strain of Origin:  (FVB/NJ x C57BL/6J)F1
Mutation
description
Allele Type:    Endonuclease-mediated (Not Specified)
Mutation:    Intragenic deletion
 
Mutation detailsCRISPR/cas9 genome editing used guide RNAs (AACTTGCAGTAATTGTCATT and AGGATTGGAAACCTGCTGGTG) to target exon 4. The resulting indel mutation deleted 7 bp in exon 4. (J:94077)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Dhps Mutation:  19 strains or lines available
References
Original:  J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory