Dhps^em3Lutzy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dhps^em3Lutzy
• Name: deoxyhypusine synthase; endonuclease-mediated mutation 3, Cathleen Lutz
• MGI ID: MGI:6863905
• Synonyms: Dhps^N173S
• Gene: Dhps Location: Chr8:85798386-85801791 bp, + strand Genetic Position: Chr8, 41.55 cM
• Alliance: Dhps^em3Lutzy page

Mutation origin

• Strain of Origin: (FVB/NJ x C57BL/6J)F1

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: CRISPR/cas9 genome editing used guide RNAs (AACTTGCAGTAATTGTCATT and AGGATTGGAAACCTGCTGGTG) to target exon 4. Donor DNAs were created encoding a N173S mutation (AAT to TCT, asparagine to serine). (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Dhps Mutation: 21 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 1 reference(s)