About   Help   FAQ
Dhpsem3Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Dhpsem3Lutzy
Name: deoxyhypusine synthase; endonuclease-mediated mutation 3, Cathy Lutz
MGI ID: MGI:6863905
Synonyms: DhpsN173S
Gene: Dhps  Location: Chr8:85798386-85801791 bp, + strand  Genetic Position: Chr8, 41.55 cM
Alliance: Dhpsem3Lutzy page
Mutation
origin
Strain of Origin:  (FVB/NJ x C57BL/6J)F1
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Nucleotide substitutions
 
Mutation detailsCRISPR/cas9 genome editing used guide RNAs (AACTTGCAGTAATTGTCATT and AGGATTGGAAACCTGCTGGTG) to target exon 4. Donor DNAs were created encoding a N173S mutation (AAT to TCT, asparagine to serine). (J:101977)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Dhps Mutation:  19 strains or lines available
References
Original:  J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory