Pex7^em4Lutzy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pex7^em4Lutzy
• Name: peroxisomal biogenesis factor 7; endonuclease-mediated mutation 7, Cathleen Lutz
• MGI ID: MGI:6863859
• Synonyms: Pex7^del580
• Gene: Pex7 Location: Chr10:19735836-19783420 bp, - strand Genetic Position: Chr10, 9.16 cM, cytoband A3
• Alliance: Pex7^em4Lutzy page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/cas9 genome editing used guide RNAs [ACCTCCTTTCAGTTTAACTT, AGCTCCAAAGTTAAACTGAA, AGTGCCTCTAGCAGGCACGG, and GATGCCACCGTGCCTGCTAG] to target exon 3. The resulting indel mutation deleted 580 bp that included exon 3. (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Pex7 Mutation: 17 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 1 reference(s)