About   Help   FAQ
Pex7em4Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Pex7em4Lutzy
Name: peroxisomal biogenesis factor 7; endonuclease-mediated mutation 7, Cathy Lutz
MGI ID: MGI:6863859
Synonyms: Pex7del580
Gene: Pex7  Location: Chr10:19735836-19783420 bp, - strand  Genetic Position: Chr10, 9.16 cM, cytoband A3
Alliance: Pex7em4Lutzy page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Not Specified)
Mutation:    Intragenic deletion
 
Mutation detailsCRISPR/cas9 genome editing used guide RNAs [ACCTCCTTTCAGTTTAACTT, AGCTCCAAAGTTAAACTGAA, AGTGCCTCTAGCAGGCACGG, and GATGCCACCGTGCCTGCTAG] to target exon 3. The resulting indel mutation deleted 580 bp that included exon 3. (J:101977)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Pex7 Mutation:  17 strains or lines available
References
Original:  J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory