Zc4h2^em3Lutzy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zc4h2^em3Lutzy
• Name: zinc finger, C4H2 domain containing; endonuclease-mediated mutation 3, Cathy Lutz
• MGI ID: MGI:6861845
• Synonyms: Zc4h2^del394
• Gene: Zc4h2 Location: ChrX:94682799-94702115 bp, - strand Genetic Position: ChrX, 41.99 cM
• Alliance: Zc4h2^em3Lutzy page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Insertion
• Mutation details: Using CRISPR/cas9 genome editing, guide RNAs [AATAACATAGTGTAGCAGAA, CCACTGACAGATCTAAGAAT, TTGAGAACTTGAACATAGAC and GATAATAGGACAGACTCCAG] were selected to target exon 3 and delete 394 bp to generate a predicted null mutation. (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Zc4h2 Mutation: 1 strain or line available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 1 reference(s)