About   Help   FAQ
Rag1em2Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Rag1em2Lutzy
Name: recombination activating 1; endonuclease-mediated mutation 2, Cathy Lutz
MGI ID: MGI:6861839
Gene: Rag1  Location: Chr2:101468627-101479846 bp, - strand  Genetic Position: Chr2, 53.88 cM
Alliance: Rag1em2Lutzy page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready)
Mutation:    Insertion
 
Mutation detailsCRISPR/cas9 genome editing is used to insert loxP sites flanking exon 2. The following guide RNAs were selected to target upstream [AAGTGTCCCCAAATATTGTC] and downstream [GCACCTAGCACATTGCCATG] of exon 2. Rag1 transcript Rag1-201 was used as reference for the exon numbering and the guide/donor sequences. (J:101977)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Rag1 Mutation:  133 strains or lines available
References
Original:  J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory