About   Help   FAQ
Wdr33em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Wdr33em1(IMPC)Tcp
Name: WD repeat domain 33; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6857759
Gene: Wdr33  Location: Chr18:31937143-32040450 bp, + strand  Genetic Position: Chr18, 17.85 cM, cytoband B3
Alliance: Wdr33em1(IMPC)Tcp page
IMPC: Wdr33 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Not Specified)
Mutation:    Not Specified
 
Mutation details This allele was generated at The Centre for Phenogenomics using Cas9 and guides with spacer sequences CGGGCAATTCAGCCGGATGC and GGATTATTCAACATTCCTAT that targeted exon(s) ENSMUSE00000141984.2. This resulted in deletion(s) of 1 bp (location: Chr18:31962944-31962944; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Wdr33 Mutation:  64 strains or lines available
References
Original:  J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/14/2026
MGI 6.24
The Jackson Laboratory