About   Help   FAQ
Ebna1bp2em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Ebna1bp2em1(IMPC)Tcp
Name: EBNA1 binding protein 2; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6856862
Synonyms: Ebna1bp2-
Gene: Ebna1bp2  Location: Chr4:118477996-118484973 bp, + strand  Genetic Position: Chr4, 54.96 cM
Alliance: Ebna1bp2em1(IMPC)Tcp page
IMPC: Ebna1bp2 gene page
Ebna1bp2em1(IMPC)Tcp/Ebna1bp2em1(IMPC)Tcp mice exhibit embryonic lethality, with embryos recovered at E3.5 but not at E7.5. Embryos at E3.5 appear as compacted morulas. Mutants fail to hatch from the zona pellucida and are dead after 3 days in culture.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsCRISPR-targeting with single guide RNAs having spacer sequences of TCAGTTATATGTGCAATCAG targeting the 5' side and ATTTGCCTAGGCGACTGGCA targeting the 3' side of a critical region. This resulted in a 399-bp deletion Chr4:118621924-118622322(GRCm38). (J:94077)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ebna1bp2 Mutation:  18 strains or lines available
References
Original:  J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory