Arrdc4^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Arrdc4^em1(IMPC)Tcp
• Name: arrestin domain containing 4; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6856856
• Gene: Arrdc4 Location: Chr7:68386742-68398986 bp, - strand Genetic Position: Chr7, 37.81 cM, cytoband C
• Alliance: Arrdc4^em1(IMPC)Tcp page
• IMPC: Arrdc4 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR-targeting with single guide RNAs having spacer sequences of GTATGGTCTTTTTCAGGTGA targeting the 5' side and GACGCTCTGATCTGGAACTT targeting the 3' side of a critical region. This resulted in a 358-bp del Chr7: 68744854-68745211 (p.E101Sfs56*). (GRCm38). (J:94077)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Arrdc4 Mutation: 20 strains or lines available

References

• Original: J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015
• All: 2 reference(s)