Dmwd^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dmwd^em1(IMPC)J
• Name: dystrophia myotonica-containing WD repeat motif; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6849816
• Gene: Dmwd Location: Chr7:18810152-18816701 bp, + strand Genetic Position: Chr7, 9.46 cM
• Alliance: Dmwd^em1(IMPC)J page
• IMPC: Dmwd gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCGTAGCCAACCAAACGCGA and TCTCGACCCCCAAAGTCAAG, which resulted in a 6894 bp deletion beginning at Chromosome 7 position 18,809,966 bp and ending after 18,816,859 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000676908, ENSMUSE00000198585, ENSMUSE00001284052, ENSMUSE00001300660 and ENSMUSE00000412301 (exons 1-5) and 2494 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. There is an 18 bp insertion AAGGCTCATCTACCAAAA at the deletion site. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Dmwd Mutation: 30 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)