About   Help   FAQ
Rr125em2Tmhm
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr125em2Tmhm
Name: regulatory region 125; endonuclease-mediated mutation 2, Tim Mohun
MGI ID: MGI:6840226
Gene: Rr125  Location: unknown  Genetic Position: Chr7, Syntenic
Alliance: Rr125em2Tmhm page
Mutation
origin
Strain of Origin:  Not Specified
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
 
Mutation detailsNKX2-5 binding enhancer M10, upstream of Furin, was targeted with two sgRNAs (targeting ATGCGGTTGTGATCTCTCGG and GCCACCGGCAAAGGCGTGGT) using CRISPR/Cas9 technology, resulting in an 896 bp deletion in line 678. (J:273415)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr125 Mutation:  0 strains or lines available
References
Original:  J:273415 Dupays L, et al., Furin, a transcriptional target of NKX2-5, has an essential role in heart development and function. PLoS One. 2019;14(3):e0212992
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory