About   Help   FAQ
Rr118em1Dje
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr118em1Dje
Name: regulatory region 118; endonuclease-mediated mutation 1, Douglas J Epstein
MGI ID: MGI:6836766
Synonyms: SshSBE5delta2kb
Gene: Rr118  Location: Chr5:29455233-29457112 bp  Genetic Position: Chr5, Syntenic
Alliance: Rr118em1Dje page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intragenic deletion
  Rr118em1Dje involves 1 genes/genome features (Lmbr1) View all
 
Mutation detailsSsh brain enhancer SBE5, in an intron of the Lmbr1 gene, was targeted with sgRNAs (targeting CACCGTGTGCTGTTCACTTCTTGGC, AAACGCCAAGAAGTGAACAGCACAC, CACCGTAAATTATCAATGTACAGGC and AAACGCCTGTACATTGATAATTTAC) using CRISPR/Cas9 technology, resulting in the deletion of the enhancer. (J:231964)
Expression
In Mice Carrying this Mutation: 1 RNA-Seq or microarray experiment(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr118 Mutation:  0 strains or lines available
References
Original:  J:231964 Yao Y, et al., Cis-regulatory architecture of a brain signaling center predates the origin of chordates. Nat Genet. 2016 May;48(5):575-80
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory