Rr118^em1Dje
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr118^em1Dje
• Name: regulatory region 118; endonuclease-mediated mutation 1, Douglas J Epstein
• MGI ID: MGI:6836766
• Synonyms: Ssh^SBE5delta2kb
• Gene: Rr118 Location: Chr5:29455233-29457112 bp Genetic Position: Chr5, Syntenic
• Alliance: Rr118^em1Dje page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intragenic deletion
• Rr118^em1Dje involves 1 genes/genome features (Lmbr1) View all
• Mutation details: Ssh brain enhancer SBE5, in an intron of the Lmbr1 gene, was targeted with sgRNAs (targeting CACCGTGTGCTGTTCACTTCTTGGC, AAACGCCAAGAAGTGAACAGCACAC, CACCGTAAATTATCAATGTACAGGC and AAACGCCTGTACATTGATAATTTAC) using CRISPR/Cas9 technology, resulting in the deletion of the enhancer. (J:231964)

Expression

In Mice Carrying this Mutation:

1 RNA-Seq or microarray experiment(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr118 Mutation: 0 strains or lines available

References

• Original: J:231964 Yao Y, et al., Cis-regulatory architecture of a brain signaling center predates the origin of chordates. Nat Genet. 2016 May;48(5):575-80
• All: 2 reference(s)