4921539E11Rik^em1Osb
Endonuclease-mediated Allele Detail

Summary

• Symbol: 4921539E11Rik^em1Osb
• Name: RIKEN cDNA 4921539E11 gene; endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University
• MGI ID: MGI:6830917
• Gene: 4921539E11Rik Location: Chr4:103087642-103148060 bp, - strand Genetic Position: Chr4, 47.5 cM, cytoband C6
• Alliance: 4921539E11Rik^em1Osb page

Mutation origin

• Strain of Origin: (C57BL/6NJcl x DBA/2NJcl)F2

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 technology generated a 53,580 bp deletion using gRNAs TACCTGGAGCAGTAATAGAG and ACCCCATTGGATAACCTGCT. (J:315008)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any 4921539E11Rik Mutation: 36 strains or lines available

References

• Original: J:315008 Oyama Y, et al., CRISPR/Cas9-mediated genome editing reveals 12 testis-enriched genes dispensable for male fertility in mice. Asian J Androl. 2021 Jul 16
• All: 1 reference(s)