Zfp628^em1(IMPC)J
Endonuclease-mediated Allele Detail

Nomenclature

• Symbol: Zfp628^em1(IMPC)J
• Name: zinc finger protein 628; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6810759
• Gene: Zfp628 Location: Chr7:4918216-4925001 bp, + strand Genetic Position: Chr7, 2.84 cM

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGTGATGGCCGGCTCCCACG and TTCAAAACGTGTGTACCAGT, which resulted in a 3088 bp deletion beginning at Chromosome 7 position 4,921,793 bp and ending after 4,924,880 bp (GRCm39/mm39). This mutation deletes 3088 bp from ENSMUSE00000705973 (exon 3) and is predicted to cause a change of amino acid sequence after residue 4 and early truncation 34 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zfp628 Mutation: 23 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)