Zfp628em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Zfp628em1(IMPC)J |
Name: |
zinc finger protein 628; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6810759 |
Gene: |
Zfp628 Location: Chr7:4918216-4925001 bp, + strand Genetic Position: Chr7, 2.84 cM
|
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC |
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGTGATGGCCGGCTCCCACG and TTCAAAACGTGTGTACCAGT, which resulted in a 3088 bp deletion beginning at Chromosome 7 position 4,921,793 bp and ending after 4,924,880 bp (GRCm39/mm39). This mutation deletes 3088 bp from ENSMUSE00000705973 (exon 3) and is predicted to cause a change of amino acid sequence after residue 4 and early truncation 34 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
1 reference(s) |
|