Fbxo3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Nomenclature

• Symbol: Fbxo3^em1(IMPC)J
• Name: F-box protein 3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6794059
• Gene: Fbxo3 Location: Chr2:103858144-103893582 bp, + strand Genetic Position: Chr2, 54.49 cM

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTTTGTTTCCTCTCAACGT and TTACATTATGGACTGCTATA, which resulted in a 490 bp deletion beginning at Chromosome 2 position 103,873,026 bp and ending after 103,873,515 bp (GRCm39/mm39). This mutation deletes ENSMUSE00001252280 (exon 4) and 375 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 119 and early truncation 17 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Fbxo3 Mutation: 14 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)