About   Help   FAQ
Lmod1em1(IMPC)J
Endonuclease-mediated Allele Detail
Nomenclature
Symbol: Lmod1em1(IMPC)J
Name: leiomodin 1 (smooth muscle); endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6794057
Gene: Lmod1  Location: Chr1:135252551-135295803 bp, + strand  Genetic Position: Chr1, 58.51 cM, cytoband F
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTTCGGTTGAGTTCTGTAG and TCCCAGAGCCAATTAGGCCT, which resulted in a 4824 bp deletion beginning at Chromosome 1 position 135,291,253 bp and ending after 135,296,076 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000396118 and ENSMUSE00000361252 (exons 2 and 3) and 1340 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 87 and early truncation 51 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Lmod1 Mutation:  21 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
06/23/2022
MGI 6.20
The Jackson Laboratory