About   Help   FAQ
Celf5em1(IMPC)J
Endonuclease-mediated Allele Detail
Nomenclature
Symbol: Celf5em1(IMPC)J
Name: CUGBP, Elav-like family member 5; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6794034
Gene: Celf5  Location: Chr10:81295061-81318543 bp, - strand  Genetic Position: Chr10, 39.72 cM
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAGCTTGTGGCAGTAACAC and TGTCCACGAGTGGCAATCAA, which resulted in a 358 bp deletion beginning at Chromosome 10 position 81,305,085 bp and ending after 81,305,442 bp (GRCm39/mm39). This mutation deletes ENSMUSE00001294357 (exon 5) and 278 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 137 and early truncation 13 amino acids later. There is a 2bp insertion (AG) at the deletion site. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Celf5 Mutation:  19 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
06/23/2022
MGI 6.20
The Jackson Laboratory