Casp8^em1Haka
Endonuclease-mediated Allele Detail

Summary

• Symbol: Casp8^em1Haka
• Name: caspase 8; endonuclease-mediated mutation 1, Hamid Kashkar
• MGI ID: MGI:6790470
• Synonyms: Casp8^C362S
• Gene: Casp8 Location: Chr1:58834553-58886663 bp, + strand Genetic Position: Chr1, 29.19 cM, cytoband B
• Alliance: Casp8^em1Haka page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Single point mutation
• Mutation details: Cysteine codon 362 (TGC) was targeted for change to serine (AGC)(p.C362S) with an sgRNA (targeting CACCGTTTCATTCAGGCTTGCCA) and an ssODN template (CACTGGTTCAAAGTGCCCTTCCCTGTCTGGGAAACCCAAGATCTTTTTCATTCAGGCTAGCCAAGGAAGTAACTTCCAGAAAGGAGTGCCTGATGAGGCAGGCTTCGAGCAACAGAAC) using CRISPR/Cas9 technology. The mutation renders the encoded peptide enzymatically inactive. (J:285930)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Casp8 Mutation: 45 strains or lines available

References

• Original: J:285930 Fritsch M, et al., Caspase-8 is the molecular switch for apoptosis, necroptosis and pyroptosis. Nature. 2019 Nov;575(7784):683-687
• All: 2 reference(s)