Nlrp3^em1Ronz
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nlrp3^em1Ronz
• Name: NLR family, pyrin domain containing 3; endonuclease-mediated mutation 1, Rongbin Zhou
• MGI ID: MGI:6790458
• Synonyms: Nlrp3^Y30E
• Gene: Nlrp3 Location: Chr11:59432395-59457781 bp, + strand Genetic Position: Chr11, 37.73 cM, cytoband B1.3
• Alliance: Nlrp3^em1Ronz page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Nucleotide substitutions
• Mutation details: Tyrosine codon 30 (TAC) was targeted for change to glutamic acid (GAA)(p.Y30E) with an sgRNA (targeting GAAGATTACCCGCCCGAGAA) and an ssODN template (CAGTATCTAGAGGACCTTGAAGATGTGGACCTCAAGAAATTCAAAATGCATTTGGAAGATGAACCGCCCGAGAAAGGCTGTATCCCAGTCCCCAGGGGCCAGATGGAGAAGGCAGATCACTTG) using CRISPR/Cas9 technology. The mutation mimics phosphorylation at that residue in the encoded peptide. (J:291770)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Nlrp3 Mutation: 69 strains or lines available

References

• Original: J:291770 Huang Y, et al., Myeloid PTEN promotes chemotherapy-induced NLRP3-inflammasome activation and antitumour immunity. Nat Cell Biol. 2020 Jun;22(6):716-727
• All: 2 reference(s)