Ttbk1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Nomenclature

• Symbol: Ttbk1^em1(IMPC)J
• Name: tau tubulin kinase 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6784017
• Gene: Ttbk1 Location: Chr17:46753374-46798601 bp, - strand Genetic Position: Chr17, 22.9 cM

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGCACTGTCGTGGAGAAGCG and TTTCTCCTCAGTAGCCAGAT, which resulted in a 513 bp deletion beginning at Chromosome 17 position 46,789,743 bp and ending after 46,790,255 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000136846, ENSMUSE00000136848 (exons 4,5) and 298 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 85 and early truncation 27 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ttbk1 Mutation: 23 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)