Creb1^em1Rst
Endonuclease-mediated Allele Detail

Summary

• Symbol: Creb1^em1Rst
• Name: cAMP responsive element binding protein 1; endonuclease-mediated mutation 1, Randal S Tibbetts
• MGI ID: MGI:6783446
• Synonyms: Creb^E153D
• Gene: Creb1 Location: Chr1:64571963-64643707 bp, + strand Genetic Position: Chr1, 32.74 cM, cytoband C1/C5
• Alliance: Creb1^em1Rst page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Single point mutation
• Mutation details: Glutamic acid codon 153 (GAA) was targeted for change to an aspartic acid codon (GAC)(p.E153D) with an sgRNA (targeting GACTTTTCTTCTTCAATCCTTGG) and an ssODN template using CRISPR/Cas9 technology. This mutation disrupts the BS2 binding site that normally allows binding of protein phosphatase 2A through the PP2A B56 regulatory subunits. (J:307293)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Creb1 Mutation: 59 strains or lines available

References

• Original: J:307293 Kim SH, et al., Roles of constitutive and signal-dependent protein phosphatase 2A docking motifs in burst-attenuation of the cyclic AMP response element binding protein. J Biol Chem. 2021 Jun 22;:100908
• All: 1 reference(s)