About   Help   FAQ
Creb1em1Rst
Endonuclease-mediated Allele Detail
Summary
Symbol: Creb1em1Rst
Name: cAMP responsive element binding protein 1; endonuclease-mediated mutation 1, Randal S Tibbetts
MGI ID: MGI:6783446
Synonyms: CrebE153D
Gene: Creb1  Location: Chr1:64571963-64643707 bp, + strand  Genetic Position: Chr1, 32.74 cM, cytoband C1/C5
Alliance: Creb1em1Rst page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Not Specified)
Mutation:    Single point mutation
 
Mutation detailsGlutamic acid codon 153 (GAA) was targeted for change to an aspartic acid codon (GAC)(p.E153D) with an sgRNA (targeting GACTTTTCTTCTTCAATCCTTGG) and an ssODN template using CRISPR/Cas9 technology. This mutation disrupts the BS2 binding site that normally allows binding of protein phosphatase 2A through the PP2A B56 regulatory subunits. (J:307293)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Creb1 Mutation:  59 strains or lines available
References
Original:  J:307293 Kim SH, et al., Roles of constitutive and signal-dependent protein phosphatase 2A docking motifs in burst-attenuation of the cyclic AMP response element binding protein. J Biol Chem. 2021 Jun 22;:100908
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory