Casp8^em1Ieb
Endonuclease-mediated Allele Detail

Summary

• Symbol: Casp8^em1Ieb
• Name: caspase 8; endonuclease-mediated mutation 1, Igor Brodsky
• MGI ID: MGI:6781292
• Synonyms: Casp8^D387A, Casp8^DA
• Gene: Casp8 Location: Chr1:58834553-58886663 bp, + strand Genetic Position: Chr1, 29.19 cM, cytoband B
• Alliance: Casp8^em1Ieb page

Mutation origin

• Strain of Origin: (C57BL/6 x SJL)F1

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: Aspartic acid codon 387 (GAT) was targeted for change to an alanine codon (GCC)(p.D387A) with an sgRNA (targeting ACAGAACCACACTTTAGAAG) and an ssODN template (TTGCCTCATCATCTCACAAGAACTATATTCCGGATGAGGCAGAT) using CRISPR/Cas9 technology. This mutation prevents autoprocessing of the encoded peptide. (J:245476)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Casp8 Mutation: 45 strains or lines available

References

• Original: J:245476 Philip NH, et al., Activity of Uncleaved Caspase-8 Controls Anti-bacterial Immune Defense and TLR-Induced Cytokine Production Independent of Cell Death. PLoS Pathog. 2016 Oct;12(10):e1005910
• All: 8 reference(s)