Ifnar1^em1Kmiy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ifnar1^em1Kmiy
• Name: interferon (alpha and beta) receptor 1; endonuclease-mediated mutation 1, Kensuke Miyake
• MGI ID: MGI:6763171
• Synonyms: Ifnar1^-
• Gene: Ifnar1 Location: Chr16:91282126-91304329 bp, + strand Genetic Position: Chr16, 52.98 cM
• Alliance: Ifnar1^em1Kmiy page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Exon 1 was targeted with an sgRNA (targeting GCTCGCTGTCGTGGGCGCGG) and tacrRNA using CRISPR/Cas9 technology, resulting in a 757 bp deletion that includes the start codon. (J:280157)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ifnar1 Mutation: 62 strains or lines available

References

• Original: J:280157 Fukui R, et al., Cleavage of Toll-Like Receptor 9 Ectodomain Is Required for In Vivo Responses to Single Strand DNA. Front Immunol. 2018;9:1491
• All: 2 reference(s)