Il1b^em1Jevi
Endonuclease-mediated Allele Detail

Summary

• Symbol: Il1b^em1Jevi
• Name: interleukin 1 beta; endonuclease-mediated mutation 1, James E Vince
• MGI ID: MGI:6758791
• Synonyms: Il1b^K133R
• Gene: Il1b Location: Chr2:129206490-129213059 bp, - strand Genetic Position: Chr2, 62.97 cM, cytoband F
• Alliance: Il1b^em1Jevi page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Single point mutation
• Mutation details: Lysine codon 133 was targeted with an sgRNA (targeting CATATGGGTCCGACAGCACG) and an ssODN template (CTGCTGGTGTGTGACGTTCCCATTAGACAACTGCACTACAGGCTCCGAGATGAACAACAAAGAAGTCTCGTGCTGTCGGACCCATATGAGCTGAAAGCTCTCCACCTCAATGGACAGAATATCAACCA) using CRISPR/Cas9 technology, resulting in its change to an arginine codon (p.K133R) owing to an A-to-G nucleotide mutation. This change prevents ubiquitylation at amino-acid residue 133. (J:306336)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Il1b Mutation: 21 strains or lines available

References

• Original: J:306336 Vijayaraj SL, et al., The ubiquitylation of IL-1beta limits its cleavage by caspase-1 and targets it for proteasomal degradation. Nat Commun. 2021 May 11;12(1):2713
• All: 1 reference(s)