About   Help   FAQ
Il1bem1Jevi
Endonuclease-mediated Allele Detail
Summary
Symbol: Il1bem1Jevi
Name: interleukin 1 beta; endonuclease-mediated mutation 1, James E Vince
MGI ID: MGI:6758791
Synonyms: Il1bK133R
Gene: Il1b  Location: Chr2:129206490-129213059 bp, - strand  Genetic Position: Chr2, 62.97 cM, cytoband F
Alliance: Il1bem1Jevi page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Single point mutation
 
Mutation detailsLysine codon 133 was targeted with an sgRNA (targeting CATATGGGTCCGACAGCACG) and an ssODN template (CTGCTGGTGTGTGACGTTCCCATTAGACAACTGCACTACAGGCTCCGAGATGAACAACAAAGAAGTCTCGTGCTGTCGGACCCATATGAGCTGAAAGCTCTCCACCTCAATGGACAGAATATCAACCA) using CRISPR/Cas9 technology, resulting in its change to an arginine codon (p.K133R) owing to an A-to-G nucleotide mutation. This change prevents ubiquitylation at amino-acid residue 133. (J:306336)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Il1b Mutation:  21 strains or lines available
References
Original:  J:306336 Vijayaraj SL, et al., The ubiquitylation of IL-1beta limits its cleavage by caspase-1 and targets it for proteasomal degradation. Nat Commun. 2021 May 11;12(1):2713
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory