About   Help   FAQ
Zbtb9em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zbtb9em1(IMPC)J
Name: zinc finger and BTB domain containing 9; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6755462
Gene: Zbtb9  Location: Chr17:27192153-27195177 bp, + strand  Genetic Position: Chr17, 13.6 cM, cytoband B1
Alliance: Zbtb9em1(IMPC)J page
IMPC: Zbtb9 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CAAAGGAGTCGAAGCATCCA and GTAGTCATTTGTAAGTCCAG, which resulted in a 1363 bp deletion beginning at Chromosome 17 position 27,192,601 bp and ending after 27,193,963 bp (GRCm39/mm39). This mutation deletes 1363 bp from ENSMUSE00000716828 (exon 2) coding sequence and is predicted to cause a change of amino acid sequence after residue 1 and termination 16 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Zbtb9 Mutation:  40 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/13/2026
MGI 6.24
The Jackson Laboratory