Tnfsf11^em2Caob
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tnfsf11^em2Caob
• Name: tumor necrosis factor (ligand) superfamily, member 11; endonuclease-mediated mutation 2, Charles A O'Brien
• MGI ID: MGI:6754164
• Synonyms: eKO
• Gene: Tnfsf11 Location: Chr14:78514886-78545483 bp, - strand Genetic Position: Chr14, 41.26 cM
• Alliance: Tnfsf11^em2Caob page

Mutation origin

• Strain of Origin: (C57BL/6 x BALB/c)F1

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: Putative proximal enhancer sequence between -1413 and -510 bp upstream of the transcription start site (chr14:78545488 (build GRCm39)) was targeted with sgRNAs (targeting CAAGGTTTATAGGTGTTCTA and CCTCTCTTACGGGAGTCTAT) using CRISPR/Cas9 technology, resulting in a 909 bp deletion. (J:307332)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Tnfsf11 Mutation: 30 strains or lines available

References

• Original: J:307332 MacLeod RS, et al., Deletion of a putative promoter-proximal Tnfsf11 regulatory region in mice does not alter bone mass or Tnfsf11 expression in vivo. PLoS One. 2021;16(5):e0250974
• All: 1 reference(s)