Nanos2^em2Oat
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nanos2^em2Oat
• Name: nanos C2HC-type zinc finger 2; endonuclease-mediated mutation 2, Jon M Oatley
• MGI ID: MGI:6754130
• Gene: Nanos2 Location: Chr7:18721449-18722887 bp, + strand Genetic Position: Chr7, 9.45 cM
• Alliance: Nanos2^em2Oat page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: The coding region was targeted with sgRNAs (targeting TGGACCTACCGCCCTTTGAC and AGTCTCTCTACCGACGCAGT) using CRISPR/Cas9 technology, resulting in a 368 bp deletion and 2 bp insertion (GA). (J:307466)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Nanos2 Mutation: 15 strains or lines available

References

• Original: J:307466 Miao D, et al., Simplified pipelines for genetic engineering of mammalian embryos by CRISPR-Cas9 electroporation. Biol Reprod. 2019 Jul 1;101(1):177-187
• All: 1 reference(s)