About   Help   FAQ
Nanos2em2Oat
Endonuclease-mediated Allele Detail
Summary
Symbol: Nanos2em2Oat
Name: nanos C2HC-type zinc finger 2; endonuclease-mediated mutation 2, Jon M Oatley
MGI ID: MGI:6754130
Gene: Nanos2  Location: Chr7:18721449-18722887 bp, + strand  Genetic Position: Chr7, 9.45 cM
Alliance: Nanos2em2Oat page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThe coding region was targeted with sgRNAs (targeting TGGACCTACCGCCCTTTGAC and AGTCTCTCTACCGACGCAGT) using CRISPR/Cas9 technology, resulting in a 368 bp deletion and 2 bp insertion (GA). (J:307466)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Nanos2 Mutation:  16 strains or lines available
References
Original:  J:307466 Miao D, et al., Simplified pipelines for genetic engineering of mammalian embryos by CRISPR-Cas9 electroporation. Biol Reprod. 2019 Jul 1;101(1):177-187
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory