Fcrl2^em2(IMPC)H
Endonuclease-mediated Allele Detail

Summary

• Symbol: Fcrl2^em2(IMPC)H
• Name: Fc receptor like 2; endonuclease-mediated mutation 2, Harwell
• MGI ID: MGI:6750863
• Gene: Fcrl2 Location: Chr3:87158318-87171046 bp, - strand Genetic Position: Chr3, 38.19 cM, cytoband F1
• Alliance: Fcrl2^em2(IMPC)H page
• IMPC: Fcrl2 gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Medical Research Council Harwell using Cas9 and guides with spacer sequences ACCGCGTCTTGCATTCCTAA and GCCCCCTGCAGCCCGTAGAG that targeted exon(s) ENSMUSE00000175905.3 ENSMUSE00000175907.2 ENSMUSE00001874361.1 ENSMUSE00001874365.1. This resulted in deletion(s) of 375 bp (location: Chr3:87166407-87166781; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Fcrl2 Mutation: 43 strains or lines available

References

• Original: J:169366 MouseBook^TM, Information obtained from MouseBook^TM, Medical Research Council Mammalian Genetics Unit, Harwell, UK. Unpublished. 2005-2013
• All: 2 reference(s)