Tal2^em2(IMPC)H
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tal2^em2(IMPC)H
• Name: T cell acute lymphocytic leukemia 2; endonuclease-mediated mutation 2, Harwell
• MGI ID: MGI:6741499
• Gene: Tal2 Location: Chr4:53779705-53788712 bp, + strand Genetic Position: Chr4, 28.75 cM
• Alliance: Tal2^em2(IMPC)H page
• IMPC: Tal2 gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Medical Research Council Harwell using Cas9 and guides with spacer sequences AAAGACCCGCCTGCCAGATG, AGACGCTTCGCTTGGCAATG, CAAGAACGAGACGCTTCGCT, and TCATCTGGCAGGCGGGTCTT that targeted exon(s) ENSMUSE00000178974.5. This resulted in deletion(s) of 10 bp (location: Chr4:53785948-53785957; GRCm39), 81 bp (location: Chr4:53785998-53786078; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tal2 Mutation: 11 strains or lines available

References

• Original: J:169366 MouseBook^TM, Information obtained from MouseBook^TM, Medical Research Council Mammalian Genetics Unit, Harwell, UK. Unpublished. 2005-2013
• All: 2 reference(s)