Mrgprb1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mrgprb1^em1(IMPC)J
• Name: MAS-related GPR, member B1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6740190
• Gene: Mrgprb1 Location: Chr7:48093861-48106090 bp, - strand Genetic Position: Chr7, 31.11 cM
• Alliance: Mrgprb1^em1(IMPC)J page
• IMPC: Mrgprb1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAGTCTTCCGTTGAAACCGA and GATTGCACCACTCCTGAAAA, which resulted in a 776 bp deletion beginning at Chromosome 7 position 48,097,004 bp and ending after 48,097,779 bp (GRCm39/mm39). This mutation deletes 776 bp from ENSMUSE00000593974 (exon 2) and is predicted to cause a change of amino acid sequence after residue 44 and termination 15 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Mrgprb1 Mutation: 33 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)