Mrgprb1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Mrgprb1em1(IMPC)J |
| Name: |
MAS-related GPR, member B1; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6740190 |
| Gene: |
Mrgprb1 Location: Chr7:48093861-48106090 bp, - strand Genetic Position: Chr7, 31.11 cM
|
| Alliance: |
Mrgprb1em1(IMPC)J page
|
| IMPC: |
Mrgprb1 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAGTCTTCCGTTGAAACCGA and GATTGCACCACTCCTGAAAA, which resulted in a 776 bp deletion beginning at Chromosome 7 position 48,097,004 bp and ending after 48,097,779 bp (GRCm39/mm39). This mutation deletes 776 bp from ENSMUSE00000593974 (exon 2) and is predicted to cause a change of amino acid sequence after residue 44 and termination 15 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
1 reference(s) |
|