Trem2^em1Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Trem2^em1Tcp
• Name: triggering receptor expressed on myeloid cells 2; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6739869
• Synonyms: R47H TREM2
• Gene: Trem2 Location: Chr17:48653429-48659304 bp, + strand Genetic Position: Chr17, 23.99 cM, cytoband C
• Alliance: Trem2^em1Tcp page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: A G-to-A mutation was introduced to change arginine codon 47(CGC) to a histidine codon (CAC) (p.R47H) using an sgRNA (targeting ACTGGGGGAGACGCAAGGCC) and an ssODN template (CTGCAGGGCATGGCCGGCCAGTCCTTGAGGGTGTCATGTACTTATGACGCCTTGAAGCACTGGGGGAGACaCAAGGCCTGGTGTCGGCAGCTGGGTGAGGAGGGCCCATGCCAGCGTGTGGTGAGCACACACGGTGTGTGGCTGC) with CRISPR/Cas9 technology. The mutation has been indicated as an Alzheimer's Disease risk factor. (J:308299)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Trem2 Mutation: 65 strains or lines available

References

• Original: J:308299 Vilalta A, et al., Wild-type sTREM2 blocks Abeta aggregation and neurotoxicity, but the Alzheimer's R47H mutant increases Abeta aggregation. J Biol Chem. 2021 Apr 3;:100631
• All: 1 reference(s)