About   Help   FAQ
Trem2em1Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Trem2em1Tcp
Name: triggering receptor expressed on myeloid cells 2; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6739869
Synonyms: R47H TREM2
Gene: Trem2  Location: Chr17:48653429-48659304 bp, + strand  Genetic Position: Chr17, 23.99 cM, cytoband C
Alliance: Trem2em1Tcp page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation detailsA G-to-A mutation was introduced to change arginine codon 47(CGC) to a histidine codon (CAC) (p.R47H) using an sgRNA (targeting ACTGGGGGAGACGCAAGGCC) and an ssODN template (CTGCAGGGCATGGCCGGCCAGTCCTTGAGGGTGTCATGTACTTATGACGCCTTGAAGCACTGGGGGAGACaCAAGGCCTGGTGTCGGCAGCTGGGTGAGGAGGGCCCATGCCAGCGTGTGGTGAGCACACACGGTGTGTGGCTGC) with CRISPR/Cas9 technology. The mutation has been indicated as an Alzheimer's Disease risk factor. (J:308299)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Trem2 Mutation:  69 strains or lines available
References
Original:  J:308299 Vilalta A, et al., Wild-type sTREM2 blocks Abeta aggregation and neurotoxicity, but the Alzheimer's R47H mutant increases Abeta aggregation. J Biol Chem. 2021 Apr 3;:100631
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory