Kras^em1Bbd
Endonuclease-mediated Allele Detail

Summary

• Symbol: Kras^em1Bbd
• Name: Kras proto-oncogene, GTPase; endonuclease-mediated mutation 1, Mariano Barbacid
• MGI ID: MGI:6739818
• Synonyms: KRAS4B¹⁵⁴
• Gene: Kras Location: Chr6:145162425-145195965 bp, - strand Genetic Position: Chr6, 77.37 cM, cytoband G2
• Alliance: Kras^em1Bbd page

Mutation origin

• Strain of Origin: mixed

Mutation description

• Allele Type: Endonuclease-mediated (Modified isoform(s))
• Mutation: Nucleotide substitutions
• Mutation details: Alanine codon 155 (GCC) in exon 5 was changed to a stop codon (TGA) (p.A155*) using an sgRNA (targeting GGAAGATATGTAATCAGGCTCTT) and an ssODN template with CRISPR/Cas9 technology. (J:308301)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Kras Mutation: 69 strains or lines available

Notes

The guide RNAs were injected into zygotes from a cross of (C57BL/6 x CBA)F1 females with Kras^tm3Bbd/Kras⁺;Trp53^tm1.1Dgk/Trp53^tm1.1Dgk males on a mixed 129/Sv-C57BL/6 genetic background.

References

• Original: J:308301 Salmon M, et al., KRAS4A induces metastatic lung adenocarcinomas in vivo in the absence of the KRAS4B isoform. Proc Natl Acad Sci U S A. 2021 Jul 27;118(30):e2023112118
• All: 1 reference(s)