Tnfem3Boui
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Tnfem3Boui |
| Name: |
tumor necrosis factor; endonuclease-mediated mutation 3, Philippe Bouillet |
| MGI ID: |
MGI:6729285 |
| Synonyms: |
Tnfdel6, TNFdel6 |
| Gene: |
Tnf Location: Chr17:35418357-35420983 bp, - strand Genetic Position: Chr17, 18.59 cM
|
| Alliance: |
Tnfem3Boui page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Modified regulatory region) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: The new regulatory element (NRE) in the 3' UTR was targeted with gRNAs (targeting TTGTCTTAATAACGCTGATT and ATTTCTCTCAATGACCCGTA) using CRISPR/Cas9 technology, resulting in a 76 bp deletion (GCTGATTTGGTGACCAGGCTGTCGCTACATCACTGAACCTCTGCTCCCCACGGGAGCCGTGACTGTAATCGCCCTA).
(J:306876)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Tnf Mutation: |
48 strains or lines available
|
|
| Original: |
J:306876 Clayer E, et al., Severe Impairment of TNF Post-transcriptional Regulation Leads to Embryonic Death. iScience. 2020 Nov 20;23(11):101726 |
| All: |
1 reference(s) |
|