About   Help   FAQ
Tnfem1Boui
Endonuclease-mediated Allele Detail
Summary
Symbol: Tnfem1Boui
Name: tumor necrosis factor; endonuclease-mediated mutation 1, Philippe Bouillet
MGI ID: MGI:6728110
Synonyms: Tnfdel4, TNFdel4
Gene: Tnf  Location: Chr17:35418357-35420983 bp, - strand  Genetic Position: Chr17, 18.59 cM
Alliance: Tnfem1Boui page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intragenic deletion
 
Mutation detailsThe adenylate-uridylate-rich element (AU-rich element; ARE) in the 3' UTR was targeted with gRNAs (targeting GTGCAAATATAAATAGAGGG and TGCTTATGAATGTATTTATT) using CRISPR/Cas9 technology, resulting in a 71 bp deletion (TCTATTTATATTTGCACTTATTATTTATTATTTATTTATTATTTATTTATTTGCTTATGAATGTATTTATT). (J:306876)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Tnf Mutation:  48 strains or lines available
References
Original:  J:306876 Clayer E, et al., Severe Impairment of TNF Post-transcriptional Regulation Leads to Embryonic Death. iScience. 2020 Nov 20;23(11):101726
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory