Tnf^em1Boui
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tnf^em1Boui
• Name: tumor necrosis factor; endonuclease-mediated mutation 1, Philippe Bouillet
• MGI ID: MGI:6728110
• Synonyms: Tnf^del4, TNFdel4
• Gene: Tnf Location: Chr17:35418357-35420983 bp, - strand Genetic Position: Chr17, 18.59 cM
• Alliance: Tnf^em1Boui page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intragenic deletion
• Mutation details: The adenylate-uridylate-rich element (AU-rich element; ARE) in the 3' UTR was targeted with gRNAs (targeting GTGCAAATATAAATAGAGGG and TGCTTATGAATGTATTTATT) using CRISPR/Cas9 technology, resulting in a 71 bp deletion (TCTATTTATATTTGCACTTATTATTTATTATTTATTTATTATTTATTTATTTGCTTATGAATGTATTTATT). (J:306876)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Tnf Mutation: 48 strains or lines available

References

• Original: J:306876 Clayer E, et al., Severe Impairment of TNF Post-transcriptional Regulation Leads to Embryonic Death. iScience. 2020 Nov 20;23(11):101726
• All: 1 reference(s)