Cdkn1a^em1Jcs
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cdkn1a^em1Jcs
• Name: cyclin dependent kinase inhibitor 1A; endonuclease-mediated mutation 1, John C Schimenti
• MGI ID: MGI:6728078
• Synonyms: p21^-, p21^em1/Jcs
• Gene: Cdkn1a Location: Chr17:29309953-29319696 bp, + strand Genetic Position: Chr17, 15.12 cM
• Alliance: Cdkn1a^em1Jcs page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: An 11 bp deletion (GGAGCGCGTTC / GAGCGCGTTCG / AGCGCGTTCGG / GCGCGTTCGGA / CGCGTTCGGAG / GCGTTCGGAGC) was created using an sgRNA (targeting ACTTCGTCTGGGAGCGCGTT) with CRISPR/Cas9 technology. (J:307167)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Cdkn1a Mutation: 63 strains or lines available

References

• Original: J:307167 Bloom JC, et al., Sexually dimorphic DNA damage responses and mutation avoidance in the mouse germline. Genes Dev. 2020 Dec 1;34(23-24):1637-1649
• All: 1 reference(s)