About   Help   FAQ
Magi3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Magi3em1(IMPC)J
Name: membrane associated guanylate kinase, WW and PDZ domain containing 3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6727368
Gene: Magi3  Location: Chr3:103920575-104127690 bp, - strand  Genetic Position: Chr3, 45.52 cM
Alliance: Magi3em1(IMPC)J page
IMPC: Magi3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCAGGGTGTGAGAAAAACAC and TTTAGGAATGGAGCACAAAA, which resulted in a 7616 bp deletion beginning at Chromosome 3 position 103,956,433 bp and ending after 103,964,048 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000421484, ENSMUSE00000421384, ENSMUSE00000421452, and ENSMUSE00000421379 (exons 8-11) and 6694 bp of flanking intronic sequence including the splice acceptors and donors and is predicted to cause a change of amino acid sequence after residue 361 and early truncation 14 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Magi3 Mutation:  85 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory