Kl^em1Adiuj
Endonuclease-mediated Allele Detail

Summary

• Symbol: Kl^em1Adiuj
• Name: klotho; endonuclease-mediated mutation 1, MODEL-AD Center
• MGI ID: MGI:6725116
• Synonyms: KL-F/C, KL^S370C
• Gene: Kl Location: Chr5:150876072-150917282 bp, + strand Genetic Position: Chr5, 89.77 cM, cytoband G3
• Alliance: Kl^em1Adiuj page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: CRISPR/Cas9 endonuclease-mediated genome editing is used to introduce encoding a S370C missense mutation (TCC to TGC). Additionally, the following silent nucleotide change was included for targeting efficiency (L370L [CTC to CTT]. Guide RNAs (GACTTTTTTGCTCTCTCCTT and AAAGCTCAAGGTTGGTCCGA) were selected to target position 370 of exon 2. The mutation that corresponds to the human C370 codon associated with late-onset Alzheimer's disease. (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Kl Mutation: 51 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 1 reference(s)