Epha1^em3Adiuj
Endonuclease-mediated Allele Detail

Summary

• Symbol: Epha1^em3Adiuj
• Name: Eph receptor A1; endonuclease-mediated mutation 3, MODEL-AD Center
• MGI ID: MGI:6725115
• Gene: Epha1 Location: Chr6:42335421-42350202 bp, - strand Genetic Position: Chr6, 20.65 cM
• Alliance: Epha1^em3Adiuj page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 endonuclease-mediated genome editing is used to delete exons 3-10 using single stranded guide RNAs (TAGCAACCCCTTAAGATCCT and GGGCTGCCTAGGATCTTAAG upstream of exon 3 and TGGTACCAGTGCAGTTACCC and GGTACCAGTGCAGTTACCCT downstream of exon 10). (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Epha1 Mutation: 51 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 1 reference(s)