About   Help   FAQ
Jak3em1Jsca
Endonuclease-mediated Allele Detail
Summary
Symbol: Jak3em1Jsca
Name: Janus kinase 3; endonuclease-mediated mutation 1, J Simon C Arthur
MGI ID: MGI:6719599
Synonyms: Cys905Ser
Gene: Jak3  Location: Chr8:72129027-72143221 bp, + strand  Genetic Position: Chr8, 34.43 cM
Alliance: Jak3em1Jsca page
Mutation
origin
Strain of Origin:  C57BL/6NTac
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Nucleotide substitutions
 
Mutation detailsCRISPR/cas mediated recombination using a guide RNA (GGCGCTGCAGGAAGTCTCGCAGG) overlapping exon 20 introduced a Cys905Ser mutation. This mutation does not alter catalytic activity but greatly increases the IC50 for covalent JAK3 inhibitors. (J:306290)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Jak3 Mutation:  85 strains or lines available
References
Original:  J:306290 Remenyi J, et al., Generation of a chemical genetic model for JAK3. Sci Rep. 2021 May 12;11(1):10093
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/13/2026
MGI 6.24
The Jackson Laboratory