Jak3^em1Jsca
Endonuclease-mediated Allele Detail

Summary

• Symbol: Jak3^em1Jsca
• Name: Janus kinase 3; endonuclease-mediated mutation 1, J Simon C Arthur
• MGI ID: MGI:6719599
• Synonyms: Cys905Ser
• Gene: Jak3 Location: Chr8:72129027-72143221 bp, + strand Genetic Position: Chr8, 34.43 cM
• Alliance: Jak3^em1Jsca page

Mutation origin

• Strain of Origin: C57BL/6NTac

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: CRISPR/cas mediated recombination using a guide RNA (GGCGCTGCAGGAAGTCTCGCAGG) overlapping exon 20 introduced a Cys905Ser mutation. This mutation does not alter catalytic activity but greatly increases the IC50 for covalent JAK3 inhibitors. (J:306290)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Jak3 Mutation: 84 strains or lines available

References

• Original: J:306290 Remenyi J, et al., Generation of a chemical genetic model for JAK3. Sci Rep. 2021 May 12;11(1):10093
• All: 1 reference(s)