Tnfaip3^em3Ama
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tnfaip3^em3Ama
• Name: tumor necrosis factor, alpha-induced protein 3; endonuclease-mediated mutation 3, Averil Ma
• MGI ID: MGI:6716906
• Synonyms: A20^ZF7deltaFGN
• Gene: Tnfaip3 Location: Chr10:18876658-18891158 bp, - strand Genetic Position: Chr10, 8.08 cM
• Alliance: Tnfaip3^em3Ama page

Mutation origin

• Germline Transmission: Earliest citation of germline transmission: J:306576
• Parent Cell Line: PRX-B6T (ES Cell)
• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Nucleotide substitutions
• Mutation details: A 9 bp in-frame deletion was introduced in the sequence encoding the 7th zinc finger using an sgRNA (targeting GCCCCTGCTTGTGATCACTTTGG) and an ssODN template with CRISPR/Cas9 technology. The deletion removes phenylanaline codon 755, glycine 756 and asparagine 757. (J:306576)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Tnfaip3 Mutation: 44 strains or lines available

References

• Original: J:306576 Razani B, et al., Non-catalytic ubiquitin binding by A20 prevents psoriatic arthritis-like disease and inflammation. Nat Immunol. 2020 Apr;21(4):422-433
• All: 1 reference(s)